Home   >    Reagents   >   Assay Substrates

DNMT Substrate-1

The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
Catalog No. D53-58


Shop Online



Catalog No. Pack Size Price (USD)
D53-58-05 5 ug $105
D53-58-BULK BULK Contact Us  


No overview information available.


Storage, Stability and Shipping:

Store product at –20oC. For optimal storage, aliquot diluted product into smaller quantities and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple freeze/thaw cycles.


Molecular Weight:

The size of double-stranded oligonucleotide is 34 base pairs. The molecular weight is 20891.54.


Format:

White to off-white lyophilized powder.



Product Datasheets



There are no related publications available for this product.


RESEARCH AREAS

Apoptosis/Autophagy, Cancer, Cell Cycle, Neurobiology


RELATED PRODUCTS


  DNMT3A, Active, D353-380G

  DNMT3B, Active, D353-380BG

  DNMT3L, Active, D353-380CG

  TRDMT1 (DNMT2) Protein, T352-30G


SIGNALCHEM BIOTECH INC.


About

Terms of Service

Privacy Policy

Get the latest resources, updates and offers in your inbox